G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Result code in IS VaVaI

<a href="https://www.isvavai.cz/riv?ss=detail&h=RIV%2F68081707%3A_____%2F21%3A00554847" target="_blank" >RIV/68081707:_____/21:00554847 - isvavai.cz</a>

Alternative codes found

RIV/00216224:14740/21:00120225

Result on the web

<a href="https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895" target="_blank" >https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895</a>

DOI - Digital Object Identifier

<a href="http://dx.doi.org/10.1002/chem.202100895" target="_blank" >10.1002/chem.202100895</a>

Result language

angličtina

Original language name

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Original language description

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Czech name

—

Czech description

—

Type

J_imp - Article in a specialist periodical, which is included in the Web of Science database

CEP classification

—

OECD FORD branch

10608 - Biochemistry and molecular biology

Project

Result was created during the realization of more than one project. More information in the Projects tab.

Continuities

P - Projekt vyzkumu a vyvoje financovany z verejnych zdroju (s odkazem do CEP)

Publication year

2021

Confidentiality

S - Úplné a pravdivé údaje o projektu nepodléhají ochraně podle zvláštních právních předpisů

Name of the periodical

Chemistry - A European Journal

ISSN

0947-6539

e-ISSN

1521-3765

Volume of the periodical

27

Issue of the periodical within the volume

47

Country of publishing house

DE - GERMANY

Number of pages

11

Pages from-to

12115-12125

UT code for WoS article

000674838100001

EID of the result in the Scopus database

2-s2.0-85110740007