All

What are you looking for?

All
Projects
Results
Organizations

Quick search

  • Projects supported by TA ČR
  • Excellent projects
  • Projects with the highest public support
  • Current projects

Smart search

  • That is how I find a specific +word
  • That is how I leave the -word out of the results
  • “That is how I can find the whole phrase”

Filters

4 925 (0,08s)

Result

histoneHMM: Differential analysis of histone modifications with broad genomic footprints

histoneHMM is a fast algorithm written in C++ and compiled as an R package. It runs in the popular R computing environment and thus seamlessly integrates with the extensive bioinformatic tool sets available through Bioconductor. This makes histoneHMM...

EB - Genetika a molekulární biologie

  • 2015
  • Jx
  • Link
Result

PAPerFly: Partial Assembly-based Peak Finder for ab initio binding site reconstruction

than an aggregation of ChIP-seq agnostic tools. Our tool is freely available in the sequence enrichment are identified. Our approach was tested by processing several ChIP-seq experiments available in the ENCODE da...

Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8)

  • 2023
  • Jimp
  • Link
Result

Differential oestrogen receptor binding is associated with clinical outcome in breast cancer

immunoprecipitation followed by high-throughput sequencing (ChIP-seq), in primary breast cancers...

FD - Onkologie a hematologie

  • 2012
  • Jx
  • Link
Result

The transcription factor Roc1 is a key regulator of cellulose degradation in the wood-decaying mushroom Schizophyllum commune.

Wood-degrading fungi in the phylum Basidiomycota play a crucial role in nutrient recycling by breaking down all components of wood. Fungi have evolved transcriptional networks that regulate expression of wood-degrading enzymes, allowing them to prior...

Mycology

  • 2022
  • Jimp
  • Link
Result

Genexpi: a toolset for identifying regulons and validating gene regulatory networks using time-course expression data

data measured with microarrays or RNA-seq combined with static binding experiments (eg., ChIP-seq) or literature mining may be used for inference of sigma factor by combining candidates obtained from ChIP experime...

Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8)

  • 2018
  • O
Result

Repeat Composition of CenH3-chromatin and H3K9me2-marked heterochromatin in Sugar Beet (Beta vulgaris)

performed chromatin immunoprecipitation followed by sequencing (ChIP-Seq) using identification of repetitive genome portions by ChIP-Seq experiments complemented the sugar) and the heterochromatic mark of dimethyl...

EB - Genetika a molekulární biologie

  • 2016
  • Jx
  • Link
Result

Demystifying emerging bulk RNA-Seq applications: the application and utility of bioinformatic methodology

sequencing (RNA-Seq) applications have evolved in conjunction with sequence technology and bioinformatic tools advances. In most projects, bulk RNA-Seq data is used to measure gene polymorphisms. However, RNA-Seq holds far...

Biochemistry and molecular biology

  • 2021
  • Jimp
  • Link
Result

A weak first-order theory of sequences

We introduce a first-order theory Seq which is mutually interpretable with Robinson’s Q. The universe of a standard model for Seq consists of sequences. We prove that Seq directly interprets the adjunctive set theory AST, a...

Pure mathematics

  • 2024
  • D
  • Link
Result

Prospects of telomere-to-telomere assembly in barley: Analysis of sequence gaps in the MorexV3 reference genome

, complemented by ChIP-seq data for centromeric histone variant CENH3, were used to estimate...

Genetics and heredity (medical genetics to be 3)

  • 2022
  • Jimp
  • Link
Result

How to diagnose colorectal cancer

: TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO: 1)), miR-23a-3p (sequence: AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 3)), miR-27a-3p (sequence: UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 4)). )) And one or more miRNAs selected from miR-142-5p...

Oncology

  • 2021
  • P
  • Link
  • 1 - 10 out of 4 925