Filters
histoneHMM: Differential analysis of histone modifications with broad genomic footprints
histoneHMM is a fast algorithm written in C++ and compiled as an R package. It runs in the popular R computing environment and thus seamlessly integrates with the extensive bioinformatic tool sets available through Bioconductor. This makes histoneHMM...
EB - Genetika a molekulární biologie
- 2015 •
- Jx •
- Link
Rok uplatnění
Jx - Nezařazeno - Článek v odborném periodiku (Jimp, Jsc a Jost)
Výsledek na webu
PAPerFly: Partial Assembly-based Peak Finder for ab initio binding site reconstruction
than an aggregation of ChIP-seq agnostic tools. Our tool is freely available in the sequence enrichment are identified. Our approach was tested by processing several ChIP-seq experiments available in the ENCODE da...
Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8)
- 2023 •
- Jimp •
- Link
Rok uplatnění
Jimp - Článek v periodiku v databázi Web of Science
Výsledek na webu
Differential oestrogen receptor binding is associated with clinical outcome in breast cancer
immunoprecipitation followed by high-throughput sequencing (ChIP-seq), in primary breast cancers...
FD - Onkologie a hematologie
- 2012 •
- Jx •
- Link
Rok uplatnění
Jx - Nezařazeno - Článek v odborném periodiku (Jimp, Jsc a Jost)
Výsledek na webu
The transcription factor Roc1 is a key regulator of cellulose degradation in the wood-decaying mushroom Schizophyllum commune.
Wood-degrading fungi in the phylum Basidiomycota play a crucial role in nutrient recycling by breaking down all components of wood. Fungi have evolved transcriptional networks that regulate expression of wood-degrading enzymes, allowing them to prior...
Mycology
- 2022 •
- Jimp •
- Link
Rok uplatnění
Jimp - Článek v periodiku v databázi Web of Science
Výsledek na webu
Genexpi: a toolset for identifying regulons and validating gene regulatory networks using time-course expression data
data measured with microarrays or RNA-seq combined with static binding experiments (eg., ChIP-seq) or literature mining may be used for inference of sigma factor by combining candidates obtained from ChIP experime...
Computer sciences, information science, bioinformathics (hardware development to be 2.2, social aspect to be 5.8)
- 2018 •
- O
Rok uplatnění
O - Ostatní výsledky
Repeat Composition of CenH3-chromatin and H3K9me2-marked heterochromatin in Sugar Beet (Beta vulgaris)
performed chromatin immunoprecipitation followed by sequencing (ChIP-Seq) using identification of repetitive genome portions by ChIP-Seq experiments complemented the sugar) and the heterochromatic mark of dimethyl...
EB - Genetika a molekulární biologie
- 2016 •
- Jx •
- Link
Rok uplatnění
Jx - Nezařazeno - Článek v odborném periodiku (Jimp, Jsc a Jost)
Výsledek na webu
Demystifying emerging bulk RNA-Seq applications: the application and utility of bioinformatic methodology
sequencing (RNA-Seq) applications have evolved in conjunction with sequence technology and bioinformatic tools advances. In most projects, bulk RNA-Seq data is used to measure gene polymorphisms. However, RNA-Seq holds far...
Biochemistry and molecular biology
- 2021 •
- Jimp •
- Link
Rok uplatnění
Jimp - Článek v periodiku v databázi Web of Science
Výsledek na webu
A weak first-order theory of sequences
We introduce a first-order theory Seq which is mutually interpretable with Robinson’s Q. The universe of a standard model for Seq consists of sequences. We prove that Seq directly interprets the adjunctive set theory AST, a...
Pure mathematics
- 2024 •
- D •
- Link
Rok uplatnění
D - Stať ve sborníku
Výsledek na webu
Prospects of telomere-to-telomere assembly in barley: Analysis of sequence gaps in the MorexV3 reference genome
, complemented by ChIP-seq data for centromeric histone variant CENH3, were used to estimate...
Genetics and heredity (medical genetics to be 3)
- 2022 •
- Jimp •
- Link
Rok uplatnění
Jimp - Článek v periodiku v databázi Web of Science
Výsledek na webu
How to diagnose colorectal cancer
: TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO: 1)), miR-23a-3p (sequence: AUCACAUUGCCAGGGAUUUCC (SEQ ID NO: 3)), miR-27a-3p (sequence: UUCACAGUGGCUAAGUUCCGC (SEQ ID NO: 4)). )) And one or more miRNAs selected from miR-142-5p...
Oncology
- 2021 •
- P •
- Link
Rok uplatnění
P - Patent
Výsledek na webu
- 1 - 10 out of 4 925