All

What are you looking for?

All
Projects
Results
Organizations

Quick search

  • Projects supported by TA ČR
  • Excellent projects
  • Projects with the highest public support
  • Current projects

Smart search

  • That is how I find a specific +word
  • That is how I leave the -word out of the results
  • “That is how I can find the whole phrase”

Reaction mixture for PCR amplification of the readthrough domain of turnip yellows virus in cultivated and non-cultivated plant samples

The result's identifiers

  • Result code in IS VaVaI

    <a href="https://www.isvavai.cz/riv?ss=detail&h=RIV%2F00027006%3A_____%2F22%3A10175651" target="_blank" >RIV/00027006:_____/22:10175651 - isvavai.cz</a>

  • Result on the web

  • DOI - Digital Object Identifier

Alternative languages

  • Result language

    čeština

  • Original language name

    Reakční směs pro amplifikaci readthrough domény viru žloutenky vodnice v kulturních i nekulturních vzorcích rostlin metodou PCR

  • Original language description

    Toto řešení se týká reakční směsi se specifickými primery (TuYf6_F o sekvenci CCTAGCAGGTTTCACCGCA, TuYV_5rtpR:CAGCGGGTCCAACAACAAAG, TuYV_3rtpF: AACCAACCTCAAGCACCACA, TuYV3terR1: TCGCCTCGTATCACTACCAAC) pro amplifikaci fragmentů readthrough domény viru žloutenky vodnice (turnip yellows virus - TuYV) ve vzorcích řepky a dalších rostlinách pomocí specifických primerů metodou polymerázové řetězové reakce (PCR).

  • Czech name

    Reakční směs pro amplifikaci readthrough domény viru žloutenky vodnice v kulturních i nekulturních vzorcích rostlin metodou PCR

  • Czech description

    Toto řešení se týká reakční směsi se specifickými primery (TuYf6_F o sekvenci CCTAGCAGGTTTCACCGCA, TuYV_5rtpR:CAGCGGGTCCAACAACAAAG, TuYV_3rtpF: AACCAACCTCAAGCACCACA, TuYV3terR1: TCGCCTCGTATCACTACCAAC) pro amplifikaci fragmentů readthrough domény viru žloutenky vodnice (turnip yellows virus - TuYV) ve vzorcích řepky a dalších rostlinách pomocí specifických primerů metodou polymerázové řetězové reakce (PCR).

Classification

  • Type

    F<sub>uzit</sub> - Utility model

  • CEP classification

  • OECD FORD branch

    40106 - Agronomy, plant breeding and plant protection; (Agricultural biotechnology to be 4.4)

Result continuities

  • Project

    <a href="/en/project/TM01000044" target="_blank" >TM01000044: The analysis of rapeseed resistance to viral pathogens</a><br>

  • Continuities

    P - Projekt vyzkumu a vyvoje financovany z verejnych zdroju (s odkazem do CEP)

Others

  • Publication year

    2022

  • Confidentiality

    S - Úplné a pravdivé údaje o projektu nepodléhají ochraně podle zvláštních právních předpisů

Data specific for result type

  • Patent/design ID

    36185

  • Publisher

    CZ001 -

  • Publisher name

    Industrial Property Office

  • Place of publication

    Prague

  • Publication country

    CZ - CZECH REPUBLIC

  • Date of acceptance

  • Owner name

    Výzkumný ústav rostlinné výroby, v.v.i.

  • Method of use

    A - Výsledek využívá pouze poskytovatel

  • Usage type

    N - Využití výsledku jiným subjektem je možné bez nabytí licence (výsledek není licencován)