G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Kód výsledku v IS VaVaI

<a href="https://www.isvavai.cz/riv?ss=detail&h=RIV%2F68081707%3A_____%2F21%3A00554847" target="_blank" >RIV/68081707:_____/21:00554847 - isvavai.cz</a>

Nalezeny alternativní kódy

RIV/00216224:14740/21:00120225

Výsledek na webu

<a href="https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895" target="_blank" >https://chemistry-europe.onlinelibrary.wiley.com/doi/10.1002/chem.202100895</a>

DOI - Digital Object Identifier

<a href="http://dx.doi.org/10.1002/chem.202100895" target="_blank" >10.1002/chem.202100895</a>

Jazyk výsledku

angličtina

Název v původním jazyce

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Popis výsledku v původním jazyce

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Název v anglickém jazyce

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Popis výsledku anglicky

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally, however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Druh

J_imp - Článek v periodiku v databázi Web of Science

CEP obor

—

OECD FORD obor

10608 - Biochemistry and molecular biology

Projekt

Výsledek vznikl pri realizaci vícero projektů. Více informací v záložce Projekty.

Návaznosti

P - Projekt vyzkumu a vyvoje financovany z verejnych zdroju (s odkazem do CEP)

Rok uplatnění

2021

Kód důvěrnosti údajů

S - Úplné a pravdivé údaje o projektu nepodléhají ochraně podle zvláštních právních předpisů

Název periodika

Chemistry - A European Journal

ISSN

0947-6539

e-ISSN

1521-3765

Svazek periodika

27

Číslo periodika v rámci svazku

47

Stát vydavatele periodika

DE - Spolková republika Německo

Počet stran výsledku

11

Strana od-do

12115-12125

Kód UT WoS článku

000674838100001

EID výsledku v databázi Scopus

2-s2.0-85110740007